Custom DNA oligos-set primeri (10 buc)- Primer (amorsă ADN) PCR- 1 set- 600,00 lei A1125-Wizard® Genomic DNA Purification Kit, 500 isolations x 300 µl - Promega-1 kit-2.318,00 lei A6010-GoTaq® 2 step RT-qPCR System, 5ml (50 × 20µl RT reactions and 500 × 20µl qPCR reactions) - Promega-1 kit -1.343,00 lei 1096341000-2-Propanol, for analysis EMSURE® ACS-1 l-246,00 lei 1009831000-Ethanol absolute for analysis EMSURE® ACS-1 l-27...

Custom DNA oligos-set primeri (10 buc)- Primer (amorsă ADN) PCR- 1 set- 600,00 lei A1125-Wizard® Genomic DNA Purification Kit, 500 isolations x 300 µl - Promega-1 kit-2.318,00 lei A6010-GoTaq® 2 step RT-qPCR System, 5ml (50 × 20µl RT reactions and 500 × 20µl qPCR reactions) - Promega-1 kit -1.343,00 lei 1096341000-2-Propanol, for analysis EMSURE® ACS-1 l-246,00 lei 1009831000-Ethanol absolute for analysis EMSURE® ACS-1 l-277,00 lei E4871-QuantiFluor® ONE dsDNA System, 100 reactions - Promega-2 kit- 684,00 lei 22.001-Solutie decontaminare acizi-nucleici instrumentar/suprafete Termi-DNA-tor-flac 450 ml - BioTools-1 buc-130,00 lei Custom qPCR Probe-Sonda INFAM PROBE, 2 buc (KPC cu Secventa 5'-3': 5' FAM AATACAGTGATAACGCCGCCG 3' BHQ-1 si VIM cu Secventa 5'-3: 5' 5' HEX GGCAACGTACGCATCACCGTC 3' BHQ-2- 2 buc-2.400,00 lei Custom DNA oligos-set 4 primeri (Primer (amorsă ADN) PCR KPC FOR Secventa: ATATCTGACAACAGGCATGAC; Primer (amorsă ADN) PCR KPC REV Secventa: CCAACTCCTTCAGCAACAAA; Primer (amorsă ADN) PCR VIM FOR Secventa: TCTCCACGCACTTTCATGAC; Primer (amorsă ADN) PCR VIM REV Secventa: GTGGGAATCTCGTTCCCCTC )-240,00 lei A6101-GoTaq® Probe qPCR Mastermix, 200 reactii-1 kit-478,00 lei A1223-PureYield™ Plasmid Miniprep System, 100 reactii-1 kit-779,00 le

Arata tot

Arata mai putin